View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18928_low_35 (Length: 258)
Name: NF18928_low_35
Description: NF18928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18928_low_35 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 246
Target Start/End: Original strand, 31058426 - 31058655
Alignment:
| Q |
16 |
gtttggattatttaaaagtaatgttatctatttcatcacttaccatatgaatggatatcccagaaagaatgtgatctctagtatgcctcttgtgtatgaa |
115 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31058426 |
gtttagattatttaaaagtaatggtatctatttcatcacttaccataagaatggatatcccagaaagaatgtgatctccagtatgcctcttgtgtatgaa |
31058525 |
T |
|
| Q |
116 |
tggatatccagagagaatctgtttttaactttgtattcacaattcacttatgtatcctcatgttggagcaatagcaacgtctcaacccatcgtgttgtaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31058526 |
tggatatccagagagaatctgtttttaactttgtattcacaattcacttatgtatcctcatgttggagcaatagcaacgtctcaaaccatcgtgttgtaa |
31058625 |
T |
|
| Q |
216 |
attgaaccaaaaacatagttcatagcagaat |
246 |
Q |
| |
|
|| |||||||||||| |||||||||||||| |
|
|
| T |
31058626 |
ctttaaccaaaaacat-gttcatagcagaat |
31058655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University