View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18928_low_43 (Length: 239)
Name: NF18928_low_43
Description: NF18928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18928_low_43 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 17 - 239
Target Start/End: Complemental strand, 16790259 - 16790036
Alignment:
| Q |
17 |
aggtatcatagatggtaatgacgatttctcctacaaaggaagttacgtacaattatcccttttgaaacgtatcaaattactatacgtattagttaaaaga |
116 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16790259 |
aggtatcatggatggtaatgacgatttctcctacaaaggaagttacgtacaattatcccttttgaaacgtatcaaattactatacgtattagttaaaaga |
16790160 |
T |
 |
| Q |
117 |
ctgcattaatttttctattagnnnnnnnaaaacttattcaataaatcgtttgacc-nnnnnnnncttctcatatgctacctttgttggaattgatcatat |
215 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||| ||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16790159 |
ctgcattaatttttatattactttttttaaaacttattcaataaatcatttgaccttttttcttcttctcatatgctacctttattggaattgatcatat |
16790060 |
T |
 |
| Q |
216 |
tttacttcaatatctatggccttc |
239 |
Q |
| |
|
|||||||||| ||||||||||||| |
|
|
| T |
16790059 |
tttacttcaacatctatggccttc |
16790036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University