View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18928_low_49 (Length: 222)

Name: NF18928_low_49
Description: NF18928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18928_low_49
NF18928_low_49
[»] chr4 (1 HSPs)
chr4 (14-205)||(28106982-28107173)


Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 14 - 205
Target Start/End: Original strand, 28106982 - 28107173
Alignment:
14 gtgaaggaggtcactagtactacagcatgatagctggtttctttcatgagaaaatgatatttgtacatgtggtcgttcaactgcttttagcaacatgaca 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28106982 gtgaaggaggtcactagtactacagcatgatagctggtttctttcatgagaaaatgatatttgtacatgtggtcgttcaactgcttttagcaacatgaca 28107081  T
114 aaggacaaagtttttcacaccatgtctcacgttattggggaagtgagaataggtgtgaccgatatatttggtatggctttgaattgaggaaa 205  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
28107082 aaggacaaagtttttcacaccatgtctcacgttattggggaagtgagaataggtgtgaccgatatatttggtatggttttgaattgaggaaa 28107173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University