View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18928_low_50 (Length: 215)
Name: NF18928_low_50
Description: NF18928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18928_low_50 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 17 - 196
Target Start/End: Complemental strand, 11844650 - 11844471
Alignment:
| Q |
17 |
aaaatcttctcattatggactttgcagaaatagatgttgcacatggttgttcgtcgaatcggatgcaacacaaacaatttctctcttctctactggtgaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
11844650 |
aaaatcttctcattatggactttgcagaaatagatgttgcacatggttgttcgtcgaatcggatgcaacacaaacaatttctctcttctctactggcgaa |
11844551 |
T |
|
| Q |
117 |
atttagcaaaacaatgtgataaaattgtaaagagaaattatgatgttaggattatgcttagtatgtctttcgcataaggg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11844550 |
atttagcaaaacaatgtgataaaattgtaaagagaaattatgatgttaggtttatgcttagtatgtctttcgcataaggg |
11844471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University