View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18929_high_10 (Length: 254)
Name: NF18929_high_10
Description: NF18929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18929_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 12 - 241
Target Start/End: Complemental strand, 12839596 - 12839367
Alignment:
| Q |
12 |
gaatatccatcacatgagaattatctaggaaccctgcataaatattatctaaaaccaactgatatttaccctcgggtttggtcataaaactcaacttaac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12839596 |
gaatatccatcacatgagaattatctaggaaccctgcataaatattatctaaaaccaactgatatttaccctcgggtttggtcataaaactcaacttaac |
12839497 |
T |
|
| Q |
112 |
aaacaatatgttgatttgatactgaaggtacctaaactagatggttccaaacaagcttgccactagagtcatttttaatatagataatctcaatttccat |
211 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12839496 |
caacaatatgttgatttgatggtgaaggtacctaaactagatggttccaaacaagcttgccactagagtcatttttaatatagataatctcaatttccat |
12839397 |
T |
|
| Q |
212 |
tatagtgtcatgagaaacgggtattgaact |
241 |
Q |
| |
|
||||||| ||||||| |||||||||||||| |
|
|
| T |
12839396 |
tatagtgccatgagagacgggtattgaact |
12839367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University