View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18929_low_10 (Length: 254)
Name: NF18929_low_10
Description: NF18929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18929_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 31058390 - 31058625
Alignment:
| Q |
1 |
aaagtggtatgaaattgaatataataagattcttttgtttggattatttaaaagtaatgttatctatttcatcacttaccatatgaatggatatcccaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31058390 |
aaagtggtatgaaattgaatataataagattcttttgtttagattatttaaaagtaatggtatctatttcatcacttaccataagaatggatatcccaga |
31058489 |
T |
 |
| Q |
101 |
aagaatgtgatctctagtatgcctcttgtgtatgaatggatatccagagagaatctgtttttaactttgtattcacaattcacttatgtatcctcatgtt |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31058490 |
aagaatgtgatctccagtatgcctcttgtgtatgaatggatatccagagagaatctgtttttaactttgtattcacaattcacttatgtatcctcatgtt |
31058589 |
T |
 |
| Q |
201 |
ggagcaatagcaacgtctcaacccatcgtgttgtaa |
236 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31058590 |
ggagcaatagcaacgtctcaaaccatcgtgttgtaa |
31058625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University