View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1892_high_6 (Length: 264)
Name: NF1892_high_6
Description: NF1892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1892_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 2367126 - 2367380
Alignment:
| Q |
1 |
tctataagtacctcatttccgtttcaccttcaaacatgtcacaccgcgctccgaggtattgtcctctttaggtgtaagctcttcacggttttaacgaaag |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2367126 |
tctataagtacctcttttccgtttcaccttcaaacatgtcacaccgcgttccgaggtattgtcctctttaggtgtaagctcttcacggttttaacgaaag |
2367225 |
T |
 |
| Q |
101 |
acgaatcgttgtattgtatataaactacccttggttaatgttccattccactcacaagtacaccacatcatcttctcaggtattgtccactttgggtcgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
2367226 |
acgaatcgttgtattgtatataaactaccgttggttaatgttccattccactcacaagtacaccacatcatcttctcaggtattgtccactttgggttgt |
2367325 |
T |
 |
| Q |
201 |
tgagtgacctttcacagttttgtctgttataaaaagtgtctatttggattcattt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2367326 |
tgagtgacctttcacagttttgtctgttataaaaagtgtctagttggattcattt |
2367380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University