View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1892_low_7 (Length: 252)
Name: NF1892_low_7
Description: NF1892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1892_low_7 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 49 - 252
Target Start/End: Original strand, 2458332 - 2458543
Alignment:
| Q |
49 |
tagacgcacacatataactttcaaactaattaatgccatctgttttaaaaattgtggtatttattatttttgtctaaagaggaattctgatggctccact |
148 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||| ||||| ||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2458332 |
tagacacacacatataacttccaaactaattaatgtcatctattttaaaaattatggtatttattttttttgtctaaagaggaattctgatggctccact |
2458431 |
T |
 |
| Q |
149 |
ttgtgttacacaacacgattagttgctaagggattccatcaacg--------tcgactataaggacaaatttagccttgttgtcaaacaaaatggtgtta |
240 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2458432 |
ttgtattacacaacacgattagttgctaagggattccatcaacgttctggtatcgactataaggaccaatttagccttgttgtcaaacaaaatggtgtta |
2458531 |
T |
 |
| Q |
241 |
tgcatttctatt |
252 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2458532 |
tgcatttctatt |
2458543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University