View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18930_low_4 (Length: 403)
Name: NF18930_low_4
Description: NF18930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18930_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 266; Significance: 1e-148; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 115 - 384
Target Start/End: Complemental strand, 35406152 - 35405883
Alignment:
| Q |
115 |
tgacttgttccaaggcttctgtggtaatagtattaatgataaagaagggaaaggttggtgagatgaattaattaaggtgttgctcagagactcttttgaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35406152 |
tgacttgttccaaggcttctgtggtaatagtattaatgataaagaagggaaaggttggtgagatgaattaattaaggtgttgctcagagactcttttgaa |
35406053 |
T |
|
| Q |
215 |
ctttcagcatcaaatcatcattgtctgaatatgcatttgattcatgtattgatgatggtgcatgatattattgatgaagtgctgctacatgcagtttgaa |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35406052 |
ctttcagcatcaaatcatcattgtctgaatatgcatttgattcatgtattgatgatggtgcatgatattattgatgaagtgctgctgcatgcagtttgaa |
35405953 |
T |
|
| Q |
315 |
cgatttaatttttggctttgtttgggattgaacaaagggaaaatttgtgtgaggaataataagagagaag |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35405952 |
cgatttaatttttggctttgtttgggattgaacaaagggaaaatttgtgtgaggaataataagagagaag |
35405883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 35406266 - 35406185
Alignment:
| Q |
1 |
ctttcaatgcaaggaaagaaagacaagaataagctagaaaaatgtgattttcatgtgcattaccatgctaaaacaccaacac |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35406266 |
ctttcaatgcaaggaaagaaagacaagaataaactagaaaaatgtgattttcatgtgcattaccatgctaaaacaccaacac |
35406185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University