View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18930_low_7 (Length: 267)
Name: NF18930_low_7
Description: NF18930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18930_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 2724717 - 2724983
Alignment:
| Q |
1 |
taagtatgttgtttagttgtcgtgtgagtgatt-agtctcacatcgactacggatgaatgagttcgatgttggatttacctatattcccaatgctataag |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2724717 |
taagtatgttgtttagttgtcgtgtgagtgatttagtctcacatcgactacggatgaatgagttcgatgttggatttacctatattcccaatgctataag |
2724816 |
T |
|
| Q |
100 |
gttttgcgtggatatgtggtgtcaaagttcttggcgtgttcaatcattagccttgttgttgctcccgacactccccaagacttcgaaacatatttacaca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2724817 |
gttttgcgtggatatgtggtgtcaaagttcttggcgtgttcaatcattagccgtgttgttgctcccgacactccccaagacttcgaaacatatgtacaca |
2724916 |
T |
|
| Q |
200 |
tcactattaatggatctcacttctccaaagtgaacaattcactttagtgtataaaatgagtataatc |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2724917 |
tcactattaatggatctcacttctccaaagtgaacaattcactttagtgtataaaatgagtataatc |
2724983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University