View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18931_high_5 (Length: 249)
Name: NF18931_high_5
Description: NF18931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18931_high_5 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 13 - 249
Target Start/End: Complemental strand, 30075133 - 30074897
Alignment:
| Q |
13 |
aatatagcacatggacgctctctcccagcacacaaaaagaaatgtctttgtgcaatgacagtgaaactttacatcaagtatgagtgaataaacttctgag |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30075133 |
aatatagcacatggacgctctctcccagcacacaaaaagaaatgtctttgtgcgatgacagtgaaactttacatcaagcatgagtgaataaacttctgag |
30075034 |
T |
|
| Q |
113 |
aatgcacaaagggagcacaactttgcagatttacgtgggcacaaactccctggaattgggctctaaattagacacaataagccaaaggaccaagattaac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30075033 |
aatgcacaaagggagcacaactttgcagatttacgtgggcacaaactccctggaattgggctctaaattagacaaaataagccaaaggaccaagattaac |
30074934 |
T |
|
| Q |
213 |
agcatgaactgtaagacaaagcagtatgtcaggttgc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30074933 |
agcatgaactgtaagacaaagcagtatgtcaggttgc |
30074897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University