View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18931_high_6 (Length: 237)
Name: NF18931_high_6
Description: NF18931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18931_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 3521737 - 3521517
Alignment:
| Q |
1 |
ttattagtttaggaacaaatttgaccgcggcgcggccatcaattaccgaaacagcaatactttgaacaccgttaacatccttaagcgcagattcaataga |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3521737 |
ttatgagtttaggaacaaatttgaccgcggcgcggccatcaattaccgaaacagcaatactttgaacaccgttaacatccttaagcgcagattcaataga |
3521638 |
T |
|
| Q |
101 |
attaacacaggaagcacacttaatatcgctaatttgaaaggtaaccgtcttaacggaaacgttatcttcttctgtagactgtaacaacggaatcttcaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3521637 |
attaacacaggaagcacacttaatatcgctaatttgaaaggtaaccgtcttaacggaaacgttatcttcttctgtagactgtaacaacggaatcttcaca |
3521538 |
T |
|
| Q |
201 |
tcatcgattccattaccttcc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3521537 |
tcatcgattccattaccttcc |
3521517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University