View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18931_low_4 (Length: 284)
Name: NF18931_low_4
Description: NF18931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18931_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 13 - 266
Target Start/End: Original strand, 1327097 - 1327350
Alignment:
| Q |
13 |
tgaaatttgacaagagtatattgaaaaacataagggaaggttttgctgtgttagcttctgatgcaagacttaatgatgactttgtaacaaagagtgtcat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1327097 |
tgaaatttgacaagagtatattgaaaaacataagggaaggttttgctgtgttagcttctgatgcaagacttaatgatgactttgtaacaaagagtgtcat |
1327196 |
T |
 |
| Q |
113 |
tgattcctactttaatcctataaatccaacatttggaccttcttttgaaaatgattttgttcagtccatggtaaaaatgggacaaattggagtaaagaca |
212 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1327197 |
tgattcctacttcaatcctataaatccaacatttggaccttcttttgaaaatgattttgttcagtccatggtaaaaatgggacaaattggagtaaagaca |
1327296 |
T |
 |
| Q |
213 |
ggttctgttggaaacattaggcgtgtgtgctcagcatttaattgaagtcaaatt |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1327297 |
ggttctgttggaaacattaggcgtgtgtgctcagcatttaattgaagtcaaatt |
1327350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University