View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18932_high_10 (Length: 270)
Name: NF18932_high_10
Description: NF18932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18932_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 32440145 - 32439965
Alignment:
| Q |
1 |
ctcgatttgacttctgcataaaatttatgatttgctatcttgtctgaaatcgcatagcattcaacaaaatagacttcacaaaatagtggcacacgaagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
32440145 |
ctcgatttgacttctgcataaaatttatgatttgctatcttgtctgaaatcgcatagcattcaacaaaatagacttcacaaaatagtgacacacaaagat |
32440046 |
T |
 |
| Q |
101 |
tttagaattaaacataccaaacacaccctaacgaaattataagattttggaatccgtactttttatgcaacaatacattcg |
181 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32440045 |
tttagaattaaacataccaaacacactctaacgaaattataagattttggaatccgtactttttatgcaacaatacattcg |
32439965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 179 - 257
Target Start/End: Complemental strand, 32438311 - 32438233
Alignment:
| Q |
179 |
tcgaaataatcctcaaaaaagtgacaatgctgaaaatagtcaaacatgacatcaaacattattactcacacacattttc |
257 |
Q |
| |
|
||||||||||||| |||||| ||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32438311 |
tcgaaataatcctaaaaaaaatgacaatgccgaaaatagtcaaatatgacatcaaacattattactcacacacattttc |
32438233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 224 - 261
Target Start/End: Complemental strand, 15175330 - 15175293
Alignment:
| Q |
224 |
atgacatcaaacattattactcacacacattttcttct |
261 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
15175330 |
atgacatcaaacatgattacttacacacattttcttct |
15175293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 224 - 261
Target Start/End: Original strand, 24194920 - 24194957
Alignment:
| Q |
224 |
atgacatcaaacattattactcacacacattttcttct |
261 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
24194920 |
atgacatcaaacatgattacttacacacattttcttct |
24194957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 224 - 261
Target Start/End: Original strand, 29306231 - 29306268
Alignment:
| Q |
224 |
atgacatcaaacattattactcacacacattttcttct |
261 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
29306231 |
atgacatcaaacattattacttatacacattttcttct |
29306268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University