View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18932_high_11 (Length: 251)

Name: NF18932_high_11
Description: NF18932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18932_high_11
NF18932_high_11
[»] chr4 (1 HSPs)
chr4 (1-236)||(55667261-55667496)


Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 55667496 - 55667261
Alignment:
1 tgtagagattgactagaaactattgtgcatgtttttagtgactgccccttggcgttggaattttggatgcatgtagttcctctagatccttacaacagat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||  ||||||||||||||||||||||||||||||    
55667496 tgtagagattgactagaaactattgtgcatgtttttagtgactgctccttggcgttggaattttggatttatgtagttcctctagatccttacaacagat 55667397  T
101 tctttaacttgaatttgtatcaatgactcgatcttaacattgtctgcaattttggttgcgcttgcgcactactaattattcattggtcgtgatttcataa 200  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||     
55667396 tctttaacttgaatttgtatcaatggctcgatcttaacattgtctgcaattttggttgcgcttgcgcactactaattattcattgatcgtgatttcatac 55667297  T
201 taaattcatcctcatacgcatttatcttcatacgct 236  Q
    | |||||||||||||||||||| |||||||||||||    
55667296 tgaattcatcctcatacgcattcatcttcatacgct 55667261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University