View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18932_high_11 (Length: 251)
Name: NF18932_high_11
Description: NF18932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18932_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 55667496 - 55667261
Alignment:
| Q |
1 |
tgtagagattgactagaaactattgtgcatgtttttagtgactgccccttggcgttggaattttggatgcatgtagttcctctagatccttacaacagat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
55667496 |
tgtagagattgactagaaactattgtgcatgtttttagtgactgctccttggcgttggaattttggatttatgtagttcctctagatccttacaacagat |
55667397 |
T |
 |
| Q |
101 |
tctttaacttgaatttgtatcaatgactcgatcttaacattgtctgcaattttggttgcgcttgcgcactactaattattcattggtcgtgatttcataa |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
55667396 |
tctttaacttgaatttgtatcaatggctcgatcttaacattgtctgcaattttggttgcgcttgcgcactactaattattcattgatcgtgatttcatac |
55667297 |
T |
 |
| Q |
201 |
taaattcatcctcatacgcatttatcttcatacgct |
236 |
Q |
| |
|
| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
55667296 |
tgaattcatcctcatacgcattcatcttcatacgct |
55667261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University