View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18932_high_9 (Length: 276)
Name: NF18932_high_9
Description: NF18932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18932_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 34826282 - 34826509
Alignment:
| Q |
1 |
tacatcaatttttgttgatatatctaatgagtgtatctagaagtattatataaatacatcaatttttgttgatgtttctagtgcatgtgtgtatattgga |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||| || ||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
34826282 |
tacattaatttttgttgatatatctaatgcgtatatatagaagtattatataaatacatcaatttttgttgatgtttctagtgc--gtgtgtatattgca |
34826379 |
T |
 |
| Q |
101 |
gtgttatataactggttgatttcgtaggtatcaaagaccaaccaaatttataaacaacatgtgtttgtcgattgccgctagtatatgcatgtggacataa |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34826380 |
gtgttatataattggttgatttcgtaggtatcaaagaccaaccaaatttataatcaacatgtgtttgtcgattgccgctagtatatgcatgtggacataa |
34826479 |
T |
 |
| Q |
201 |
tttgcttttcatgtgtgttcttcttttcctaa |
232 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |
|
|
| T |
34826480 |
tttgcttttca--tgtgttcttcttttcctaa |
34826509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University