View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18933_low_4 (Length: 277)
Name: NF18933_low_4
Description: NF18933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18933_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 13 - 249
Target Start/End: Complemental strand, 2008281 - 2008045
Alignment:
| Q |
13 |
aatatgtatatccgtggtttcaatttttaatcactgcaactcctcatccttacattatcgttctaacatgatcaacttacatatatgtgtctgcaccaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2008281 |
aatatgtatatccgtggtttcaatttttaatcactgcaactcctcatccttacattatcgttctaacatgatcaactttcatatatgtgtctgcaccaat |
2008182 |
T |
|
| Q |
113 |
gcaagttgagttgttactaataaacttctttatacattcaataatttctgacaaacaaaagaacatccataatagaatatgtattttggatacttaaata |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2008181 |
gcaagttgagttgttactaataaacttctttatacattcaataatttctgacaaacaaaagaacatccataatagaatatgtattttggatacttaaata |
2008082 |
T |
|
| Q |
213 |
gatcctctgtgtactatgtactaatcaatcattttaa |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2008081 |
gatcctctgtgtactatgtactaatcaatcattttaa |
2008045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University