View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18933_low_8 (Length: 233)
Name: NF18933_low_8
Description: NF18933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18933_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 15084029 - 15083798
Alignment:
| Q |
1 |
ccttgttgtgttgctgtcccatttcacagcgcctgagccgtcgacaagacggagattcccgttggtttgaaactgaaaggagcccccggagtcaactgcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15084029 |
ccttgttgtgttgctgtcccatttcacagcgcctgagccgttgacaagacggagattcccgttggtttgaaactgaaaggagcccccggagtcaactgcg |
15083930 |
T |
|
| Q |
101 |
gtggagtttccagctgtccagacaactggagctccaccggagtagactactgcggcgaggaaggaaggaggggttgttggtggggtggtttggatgaaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15083929 |
atggagtttccagctgtccagacaactggagctccaccggagtagactacggcggcgaggaaggaaggaggggttgttggtggggtggtttggatgaaac |
15083830 |
T |
|
| Q |
201 |
ggagggagaaagtggaggatgatgatgtccat |
232 |
Q |
| |
|
||||||||||||||||||||| ||||| |||| |
|
|
| T |
15083829 |
ggagggagaaagtggaggatggtgatgaccat |
15083798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 59 - 184
Target Start/End: Complemental strand, 15087794 - 15087669
Alignment:
| Q |
59 |
ccgttggtttgaaactgaaaggagcccccggagtcaactgcggtggagtttccagctgtccagacaactggagctccaccggagtagactactgcggcga |
158 |
Q |
| |
|
|||||||| ||||||| ||||| || | |||||| || ||||||||||| || |||||||||||||| ||||||||||| ||||| || | ||||||| |
|
|
| T |
15087794 |
ccgttggtaagaaactggaaggaaccactggagtcgacagcggtggagttacctgctgtccagacaacaggagctccaccagagtacacaatggcggcga |
15087695 |
T |
|
| Q |
159 |
ggaaggaaggaggggttgttggtggg |
184 |
Q |
| |
|
||||||||||||| | ||||||||| |
|
|
| T |
15087694 |
ggaaggaaggaggagaggttggtggg |
15087669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University