View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18934_high_20 (Length: 284)
Name: NF18934_high_20
Description: NF18934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18934_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 13 - 268
Target Start/End: Complemental strand, 6117439 - 6117184
Alignment:
| Q |
13 |
aatatttagggtgagaagatggttttgaatccaacggaatacttcatggtttaaagggtataagtttacattgatcttaatcttagaatattaactgagt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6117439 |
aatatttagggtgagaagatggttttgaatccaacggaatacttcatggtttaaagggtataaatttacattgatcttaatcttagaatattaacggagt |
6117340 |
T |
|
| Q |
113 |
tcgaactcgaaatgtttgaatctaagacgtattttttaaccactattataaacttttatagttatattcctttgttttggaatatgaggagtgtgaggtg |
212 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
6117339 |
tcgaacttaaaatgtttgaatctaagacgtattttttaaccactattataaacttttatagttatattcctttgttttggaatatgaggagtgtgagatg |
6117240 |
T |
|
| Q |
213 |
agcaagcatactagaaagagaaggattgtgtccattgaagattatagtggaagtga |
268 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6117239 |
agcaagcatattagaaagagaaggattgtgtccattaaagattatagtggaagtga |
6117184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University