View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18934_high_21 (Length: 277)
Name: NF18934_high_21
Description: NF18934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18934_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 17 - 270
Target Start/End: Complemental strand, 33485786 - 33485531
Alignment:
| Q |
17 |
catgtttcaacaatatgatcatgttttccacaaaagctacaccattttgcattctaattccctttccctctagcaagaagtttcttgctctcaagaagat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| ||||| |
|
|
| T |
33485786 |
catgtttcaacaatatgatcatgttttccacaaaagctacaccattttgcattctaattccctttctctctagcaagaggtttcttgctctcaacaagat |
33485687 |
T |
 |
| Q |
117 |
taat--gagaagaggactcctcttgaacatgaattaaacaattttttctctcgtgttctatcaacacagnnnnnnngagtggtaataggaggtgaatgat |
214 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33485686 |
taatgagagaagaggactcctcttgaacatgaattaaacaattttttctctcgtgttctatcaacacagaaaaaaagagtggtaataggaggtgaatgat |
33485587 |
T |
 |
| Q |
215 |
taatcaagtgaatttgatattttatcattgcaaaattgtcattttgacctttgctt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33485586 |
taatcaagtgaatttgatattttatcattgcaaaattgtcattttgacctttgctt |
33485531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University