View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18934_high_26 (Length: 256)
Name: NF18934_high_26
Description: NF18934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18934_high_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 86 - 151
Target Start/End: Complemental strand, 9502443 - 9502378
Alignment:
| Q |
86 |
cgtgccggcatgttcattttacgagtggtgttggaatcctcatgcatgccttgagaggaaggtggt |
151 |
Q |
| |
|
||||| ||||||| ||||||||| |||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
9502443 |
cgtgctggcatgtctattttacgaatggtgttggaatcctcatgcgtgccttgagaggaaagtggt |
9502378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 21 - 62
Target Start/End: Complemental strand, 49250289 - 49250248
Alignment:
| Q |
21 |
aactggcacataattacaaatatcagtaaaaccattctctaa |
62 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
49250289 |
aactagcacataattacaaatatcagtaaaacctttctctaa |
49250248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University