View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18934_high_35 (Length: 238)
Name: NF18934_high_35
Description: NF18934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18934_high_35 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 30900620 - 30900844
Alignment:
| Q |
17 |
atcttttgtttcactcgttgttggatattcttcatctttttcatgtcttttaaatttgtttggatgcttttaagcttcgattacctgtacttatagagga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30900620 |
atcttttgtttcactcgttgttggatattcttcatctttt-catgtcttttaaatttgtttggatgcttttaagcttcgattacctgtacttatagagga |
30900718 |
T |
|
| Q |
117 |
caattattattctcatgacaagattatccaccagcaaatgttgatcatttgtctaatccgtcgatcttattgcaacataactaa----tgattgccaatt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |||||||||||| |
|
|
| T |
30900719 |
caattattattctcatgacaagattatccaccagcaaatgttgatcatttgtctaatccatcaatcttattgcaacataactaatgattgattgccaatt |
30900818 |
T |
|
| Q |
213 |
acatttttcacaaaatcaccaccatt |
238 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
30900819 |
acatttttcacaaaatcaccaccatt |
30900844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University