View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18934_high_38 (Length: 227)
Name: NF18934_high_38
Description: NF18934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18934_high_38 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 48418521 - 48418298
Alignment:
| Q |
7 |
aaggtacttttattcatcaacaaccttataatactcaagttcaagatgtgggaaccttctgttctaat---gttgtccaacaacaacaccctagtaatta |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48418521 |
aaggtacttttattcatcaacaaccttataatactcaagttcaagatgtgggaaccttcggttctaataccgttgtccaacaacaacaccctagtaatta |
48418422 |
T |
 |
| Q |
104 |
tcaacacggttttataaataattatgctacgaaccaggcaatgggaggacttcctactggccatggccatggttatgggttcccaggttatgaggattat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48418421 |
tcaacacggttttataaataattatgctacgaaccaggcaatgggaggacttcctactggccatggccatggttatgggttcccaggttatgaggattat |
48418322 |
T |
 |
| Q |
204 |
aggatatggcaggggccttctatt |
227 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
48418321 |
aggatatggcaggggccttctatt |
48418298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University