View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18934_low_26 (Length: 258)

Name: NF18934_low_26
Description: NF18934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18934_low_26
NF18934_low_26
[»] chr2 (1 HSPs)
chr2 (124-234)||(27283754-27283864)


Alignment Details
Target: chr2 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 124 - 234
Target Start/End: Complemental strand, 27283864 - 27283754
Alignment:
124 caaatttactaacatttaataaacaaaacaagatatctagacaatcagcaataataaaatcgatagcaacaagttttagttttccgcgaacacaattgac 223  Q
    ||||||||||||||||||| |||| ||||| |||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||| |||||||| ||    
27283864 caaatttactaacatttaacaaactaaacatgatatctagacaatcagcaataataaaatcaatagccacaagtttgagttttccgcgtacacaattaac 27283765  T
224 cacattttcca 234  Q
    |||||||||||    
27283764 cacattttcca 27283754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University