View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18934_low_27 (Length: 256)

Name: NF18934_low_27
Description: NF18934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18934_low_27
NF18934_low_27
[»] chr7 (1 HSPs)
chr7 (86-151)||(9502378-9502443)
[»] chr1 (1 HSPs)
chr1 (21-62)||(49250248-49250289)


Alignment Details
Target: chr7 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 86 - 151
Target Start/End: Complemental strand, 9502443 - 9502378
Alignment:
86 cgtgccggcatgttcattttacgagtggtgttggaatcctcatgcatgccttgagaggaaggtggt 151  Q
    ||||| |||||||  ||||||||| |||||||||||||||||||| |||||||||||||| |||||    
9502443 cgtgctggcatgtctattttacgaatggtgttggaatcctcatgcgtgccttgagaggaaagtggt 9502378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 21 - 62
Target Start/End: Complemental strand, 49250289 - 49250248
Alignment:
21 aactggcacataattacaaatatcagtaaaaccattctctaa 62  Q
    |||| |||||||||||||||||||||||||||| ||||||||    
49250289 aactagcacataattacaaatatcagtaaaacctttctctaa 49250248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University