View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18934_low_31 (Length: 243)
Name: NF18934_low_31
Description: NF18934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18934_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 8 - 227
Target Start/End: Original strand, 40113247 - 40113466
Alignment:
| Q |
8 |
gagatgaatgtacattgagccattcttatatcgatagataaatagatagatagacagcgtacctgtctcatagagggacggcgaatggaggactgttgta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40113247 |
gagatgaatgtacattgagccattcttatatcgatagataaatagatagatagacaacgtacctgtctcatagagggacggcgaatggaggactgttgta |
40113346 |
T |
|
| Q |
108 |
tgcataaagaagctgtcaagagcataagattcatctgcctaaagtcaaattcacctgctagtgaaggatctactagctgcattatatcattctttttcaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||||||||| |
|
|
| T |
40113347 |
tgcataaagaagctgtcaagagcataagattcatctgcctaaagtcaaattcacctgctagtgaaggatctaccagctccataatatcattctttttcaa |
40113446 |
T |
|
| Q |
208 |
caaaggttttgcctgaaaat |
227 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
40113447 |
caaaggttttgcctgaaaat |
40113466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University