View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18934_low_38 (Length: 230)
Name: NF18934_low_38
Description: NF18934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18934_low_38 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 12 - 53
Target Start/End: Complemental strand, 5570404 - 5570363
Alignment:
| Q |
12 |
acatcatcatcccttatttatagtaggggggatgaaaaatcc |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5570404 |
acatcatcatcccttatttatagtaggggggatgaaaaatcc |
5570363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 47 - 110
Target Start/End: Complemental strand, 27754768 - 27754705
Alignment:
| Q |
47 |
aaaatccacagttgtgtcaagaagacctttgttggataatgcctttgacactgccaacatatat |
110 |
Q |
| |
|
||||| |||||||||||||||| |||| || ||||||| ||||| |||||||||||| |||||| |
|
|
| T |
27754768 |
aaaatacacagttgtgtcaagaggacccttattggatattgcctctgacactgccaatatatat |
27754705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University