View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18935_low_12 (Length: 248)
Name: NF18935_low_12
Description: NF18935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18935_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 33126511 - 33126270
Alignment:
| Q |
1 |
gaactagcttctgaatgcggttccaaacacacaatacatgcattctttctaaatttttatcgatgtgtcccaattcattttcgaaagctctttcaaatac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |
|
|
| T |
33126511 |
gaactagcttctgaatgcggttccaaacacacaatacatgcattctttctaaatttttatcgatgtgtcccaattcattttcgaaagcactttcaaatgc |
33126412 |
T |
|
| Q |
101 |
tctggctgctatctttgttattgcaggtatgattacaggagcagctgggtcaactgtgtattacaatctgaggcttagacacccaacactagacatgcca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33126411 |
tctggctgctatctttgttattgcaggtatgattacaggagcagctgggtcaactgtgtattacaatctgaggcttagacacccaacactagacatgcca |
33126312 |
T |
|
| Q |
201 |
cttatagattatgatcttgctttgctcttccagcctatgcta |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33126311 |
cttatagattatgatcttgctttgctcttccagcctatgcta |
33126270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 120 - 241
Target Start/End: Original strand, 7568953 - 7569074
Alignment:
| Q |
120 |
attgcaggtatgattacaggagcagctgggtcaactgtgtattacaatctgaggcttagacacccaacactagacatgccacttatagattatgatcttg |
219 |
Q |
| |
|
|||||||||||||||| || ||||| |||||||| || |||||| ||||||||||| ||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
7568953 |
attgcaggtatgattatgggtgcagcattatcaactgtttactacaatatgaggcttagaaacccaacactagacatgccacttatagattatgatttgg |
7569052 |
T |
|
| Q |
220 |
ctttgctcttccagcctatgct |
241 |
Q |
| |
|
||||||| |||||||||||||| |
|
|
| T |
7569053 |
ctttgcttttccagcctatgct |
7569074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University