View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18935_low_2 (Length: 495)
Name: NF18935_low_2
Description: NF18935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18935_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 359; Significance: 0; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 359; E-Value: 0
Query Start/End: Original strand, 79 - 478
Target Start/End: Complemental strand, 8798066 - 8797667
Alignment:
| Q |
79 |
cttgcttgttctcttgtctctcactccactgcttttgtatggcaggggtatcagtggcagtgcagaaaaaggaaggtggagttttcattgggaaggtaaa |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8798066 |
cttgcttgttctcttgtctctcactccactgcttttgtatggcaggggtatcagtggcagtgcagaaaaaggaaggtagagttttcattgggaaggtaaa |
8797967 |
T |
|
| Q |
179 |
accnnnnnnnggcaccaatgcctcacactaacccttcttctgtaactcaaccttcatctctctctctacataccccgcgtgcactctactgctttctcgc |
278 |
Q |
| |
|
||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |
|
|
| T |
8797966 |
acctttttttggcaccaatgcttcacactaacccttcttctgtaactcaaccttcatctctctctctacatatcccgcgtgcactctactgctttctcac |
8797867 |
T |
|
| Q |
279 |
tccttcataaaaaaccttgtattatccactagctagagagacaaagagagattcatttcttcattaaatgctgaaaatgtgtggaaagagagattaacac |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8797866 |
tccttcataaaaaaccttgtattatccactagctagagagacaaagagagattcatttcttcattaaatgctgaaaatgtgtggaaagagagattaacac |
8797767 |
T |
|
| Q |
379 |
tcattttccaaaggaaatctgtgcaggcttttgccagtagtagaatccaaaaaacctcttcactacttcttcatgtaactgactgaaactatacaacata |
478 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8797766 |
tcattttccaaaggaaatctgtgcaggcttttgccagtagtagaatccaaaaaacctcttcactacttcttcatgtaactgactgtaactatacaacata |
8797667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 8798144 - 8798096
Alignment:
| Q |
1 |
ctcctcgatttgatcgttcctagctcactatttattactacctctctcc |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8798144 |
ctcctcgatttgatcgttcctagctcactatttattactacctctctcc |
8798096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University