View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18935_low_6 (Length: 342)
Name: NF18935_low_6
Description: NF18935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18935_low_6 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 18 - 342
Target Start/End: Complemental strand, 33126933 - 33126609
Alignment:
| Q |
18 |
aaacacttatgttttttgttgtttattacgtcatttataatattgacatgatgttatgaaattggtgatgatgcatggtaatggttttgttgagcaggaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33126933 |
aaacacttatgttttttgttgtttattacgtcatttataatattgacatgatgttatgaaattggtgatgatgcatggtaatcgttttgttgagcaggaa |
33126834 |
T |
|
| Q |
118 |
atgaagtttggttggagaattgtcgtagggtctattgtcggattttttggagcagcattgggaagtgtaggaggggtaggaggtggaggaatttttatcc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33126833 |
atgaagtttggttggagaattgtcgtagggtctattgtcggattttttggagcagcattgggaagtgtaggaggggtaggaggtggaggaatttttatcc |
33126734 |
T |
|
| Q |
218 |
ctatgctcactttgattattggttttgatccaaagtcttctacagccctctctaagtgttagtatatttctatcttatgtttattcattcttgttagata |
317 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33126733 |
ctatgctcactttgatcattggttttgatccaaagtcttctacagccctctctaagtgttagtatatttctatcttatgtttattcattcttgttagatg |
33126634 |
T |
|
| Q |
318 |
tatagtcgatgtttggatttacgtt |
342 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
33126633 |
tatagtcgatgtttggatttacgtt |
33126609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 106 - 264
Target Start/End: Original strand, 7568570 - 7568728
Alignment:
| Q |
106 |
gttgagcaggaaatgaagtttggttggagaattgtcgtagggtctattgtcggattttttggagcagcattgggaagtgtaggaggggtaggaggtggag |
205 |
Q |
| |
|
||||||||||||||||| |||| ||||| |||| | || || || ||| | |||||||| |||||||| ||||||||||| ||||| ||||||||||| | |
|
|
| T |
7568570 |
gttgagcaggaaatgaaatttgattggaaaattatagttggatcaattattggatttttgggagcagctttgggaagtgttggaggtgtaggaggtggtg |
7568669 |
T |
|
| Q |
206 |
gaatttttatccctatgctcactttgattattggttttgatccaaagtcttctacagcc |
264 |
Q |
| |
|
|||||||| |||||||||| ||||||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
7568670 |
gaatttttgtccctatgcttgctttgatcattggctttgatcccaagtcttctacagcc |
7568728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University