View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18936_high_102 (Length: 212)
Name: NF18936_high_102
Description: NF18936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18936_high_102 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 17 - 189
Target Start/End: Original strand, 49812385 - 49812557
Alignment:
| Q |
17 |
atcccttgctggtggaaaaaacatgaaaaagcatgcaacaccagctgtgagcagaagctgaatggaaacaatgatgtaaactttacggatgaaaccccat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49812385 |
atcccttgctggtggaaaaaacatgaaaaagcatgcaacaccagctgtgagcagaagctgaatggaaacaatgatgtaaactttacggatgaaaccccat |
49812484 |
T |
 |
| Q |
117 |
cggagctcaggtgactctatcatcgacggatacaggctgtcgccatgtgcgtgggaaaacccagcctcaatgt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49812485 |
cggagctcaggtgactctatcatcgacggatacaggttgtcgccatgtgcgtgggaaaatccagcctcaatgt |
49812557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University