View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18936_high_28 (Length: 425)
Name: NF18936_high_28
Description: NF18936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18936_high_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 399; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 399; E-Value: 0
Query Start/End: Original strand, 11 - 409
Target Start/End: Original strand, 4982030 - 4982428
Alignment:
| Q |
11 |
caaaggaacaattctaatgcaaaagtatgaggtaggacgcatgcttggccaaggaagttttgccaaagtttaccatgcaaggaacttaaagacaggacaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4982030 |
caaaggaacaattctaatgcaaaagtatgaggtaggacgcatgcttggccaaggaagttttgccaaagtttaccatgcaaggaacttaaagacaggacaa |
4982129 |
T |
 |
| Q |
111 |
aatgttgctatcaaggtgttcgacaaagcgatgatcatgaaagtcggtttgaaggagcaaatcaagcgtgaaatctcggttatgcgtcttgttcgacacc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4982130 |
aatgttgctatcaaggtgttcgacaaagcgatgatcatgaaagtcggtttgaaggagcaaatcaagcgtgaaatctcggttatgcgtcttgttcgacacc |
4982229 |
T |
 |
| Q |
211 |
ctaacattgtcgaattctacgaggtcatggcaagcaaaacaaagatatattttgcaatggaacaagtgaaaggtggcgagcttttccataaagtgtctcg |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4982230 |
ctaacattgtcgaattctacgaggtcatggcaagcaaaacaaagatatattttgcaatggaacaagtgaaaggtggcgagcttttccataaagtgtctcg |
4982329 |
T |
 |
| Q |
311 |
agggaagctgagggaagatatggctaggaaatatttccagcaacttattgcagctgttgatcattgtcatagaagagggatttatcatcgcgaccttaa |
409 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4982330 |
agggaagctgagggaagatatggctaggaaatatttccagcaacttattgcagctgttgatcattgtcatagaagagggatttatcatcgcgaccttaa |
4982428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University