View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18936_high_44 (Length: 316)
Name: NF18936_high_44
Description: NF18936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18936_high_44 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 13 - 299
Target Start/End: Original strand, 32967139 - 32967425
Alignment:
| Q |
13 |
aaaatgtgagtagactatatggaagccacagcttttctgggtttcagcaggagctcctcttgcatgtgtcatcatttcaaccatcatcacttttgtaatc |
112 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32967139 |
aaaatgtgagtagagtatatggaagccacagcttttctgggtttcagctggagctcctcttgcatgtgtcatcatttcaaccatcatcacttttgtaatc |
32967238 |
T |
|
| Q |
113 |
aagggtcaacttcatgatatcagtattgtaagtatctatagtgcttatgttatcatctatattattatgatttagtttcttaactaaaaaacaaatgtca |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32967239 |
aagggtcaacttcatgatatcagtattgtaagtatctatagtgcttatgttatcatctatattattatgatttagtttcttaactaaaaaaaaaatgtca |
32967338 |
T |
|
| Q |
213 |
tgttacttactagattggtaaattgcaacaaggaataaatcctgcttcagtgaatatgttgctttttcacggaaagtatcttggtct |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32967339 |
tgttacttactagattggtaaattgcaacaaggaataaatcctgcttcagtgaatatgttgctttttcacggaaagtatcttggtct |
32967425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University