View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18936_high_48 (Length: 308)
Name: NF18936_high_48
Description: NF18936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18936_high_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 12 - 272
Target Start/End: Complemental strand, 251615 - 251357
Alignment:
| Q |
12 |
atgaagccaatgtaattctcattgttgtttgtatactctgacacaaaacaaatggttttataaagttgcatacacattgcatcatctcaaagtaaacttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
251615 |
atgaagccaatgtaattctcattgttgtttgtttactctgacacaa--caaatagttttataaagttgcatacacattgcatcatctcaaagtaaacttt |
251518 |
T |
 |
| Q |
112 |
gtcataagtcattgtttgaccataaacttatctctattatgactcacaaatatgaatgtgagattgttttctatcataagtcattgtttggatgaatcac |
211 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
251517 |
attataagtcattgtttgaccataaacttatctctattatgactcacaaatatgaatgtgagattgttttctatcataagtcattgtttggatgaatcac |
251418 |
T |
 |
| Q |
212 |
tcaatgtcaaaacactcaccctacaatattaacaatcttctattcggtgtatgcgaaccat |
272 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
251417 |
tcaatgtcaaaacactcaccctacaacattaacaatcttctattcggtgtatgtgaaccat |
251357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University