View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18936_high_62 (Length: 264)
Name: NF18936_high_62
Description: NF18936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18936_high_62 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 180 - 264
Target Start/End: Complemental strand, 42156307 - 42156224
Alignment:
| Q |
180 |
taaataagatgataaatttatccatcttcacttactcaagcgggccaaattacacaatttcaattttatttttactcctaatcct |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42156307 |
taaataagatgataaatttatccatcttcacttactcaagcgggacaaattacacaatttcaatttt-tttttactcctaatcct |
42156224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University