View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18936_high_67 (Length: 257)
Name: NF18936_high_67
Description: NF18936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18936_high_67 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 16 - 182
Target Start/End: Original strand, 29222975 - 29223143
Alignment:
| Q |
16 |
aatatggcttcaatcagtggtggagttagaaataattttcagggtgggccaatttgtgctttgttcatatatactattaatagcaagattg---nnnnnn |
112 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||| ||||||| |||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
29222975 |
aatatggcttcaatcagtggcggagatagaaataattttcggggtgggtcaatttgtgctttgttcatacata-tattaatagcaagattgaaaaaaaaa |
29223073 |
T |
|
| Q |
113 |
nnggttgttacctttaatggtaaagaattattaaagtgtagcagtatgcacggttcgaaccttcatggtc |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |||| ||||||||||||||| |
|
|
| T |
29223074 |
aaggttgttacctttaatggtaaagaattattaaagtgttgcagtatgcgcggtacgaaccttcatggtc |
29223143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 31 - 70
Target Start/End: Complemental strand, 25368446 - 25368407
Alignment:
| Q |
31 |
agtggtggagttagaaataattttcagggtgggccaattt |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25368446 |
agtggtggagttagaaataattttcagggtgggctaattt |
25368407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University