View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18936_high_68 (Length: 255)
Name: NF18936_high_68
Description: NF18936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18936_high_68 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 7 - 248
Target Start/End: Complemental strand, 44609655 - 44609414
Alignment:
| Q |
7 |
gccaccaccgcctactttctacatgccaccgccaacacaatggttctcatggttggtgccactcnnnnnnnnagccaatattgcaatgttcgtgtatagc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44609655 |
gccaccaccgcctactttctacatgccaccgccaacacaatggttctcatggttggtgccactcttttttttagccaatattgcaatgttcgtgtatagc |
44609556 |
T |
 |
| Q |
107 |
atgtatatcaatgattgccctggctatttgaatgaagatgattgcctttggtatcaatatttgggaaaattttcttttcaacctttcaatgaaaaccctc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44609555 |
atgtatatcaatgattgccctggctatttgaatgaagatgattgcctttggtatcaatatttgggaaaattttcttttcaacctttcaatgaaaaccctc |
44609456 |
T |
 |
| Q |
207 |
tccttggcccttctgtccgcacgtgagaatcttctccctctc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44609455 |
tccttggcccttctgtccgcacgtgagaatcttctccctctc |
44609414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University