View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18936_high_76 (Length: 250)
Name: NF18936_high_76
Description: NF18936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18936_high_76 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 6 - 250
Target Start/End: Complemental strand, 17233089 - 17232837
Alignment:
| Q |
6 |
agtagcataggagtgtcggacacggcggcacacctagtcttataagtgcttcataattctttcctcactttgacttaagatgtatagctttttattttgt |
105 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17233089 |
agtatcataggagtgtcggacacggcggcacacctagtcttgtaagtgcttcataattctttcctcactttgacttaagatgtatagctttttattttgt |
17232990 |
T |
|
| Q |
106 |
ttcgtgaggctg----tgtaannnnnnn----aacattttctagctctcaattattgaattgaacattattattatgatatatctcaagctattaagttg |
197 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17232989 |
ttcgtgaggctgatagtgtaccccctcccccaaacattttctagctctcaattattgaattgaacattattattatgatatatctcaagctattaagttg |
17232890 |
T |
|
| Q |
198 |
ttattcgtaatcttatgatttgatataattcactgtttcaaaaacatggttcc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17232889 |
ttattcgtaatcttatgatttgatataattcactgtttcaaaaacatggttcc |
17232837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University