View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18936_high_77 (Length: 250)
Name: NF18936_high_77
Description: NF18936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18936_high_77 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 57 - 205
Target Start/End: Original strand, 45637739 - 45637887
Alignment:
| Q |
57 |
gctagggtgtgcaatagggtagtcaagactacttaccataaacttaatgcattctgaatcattagaaaattattttgcaatgagctgaagtattcaaatt |
156 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||| |||||||| |||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
45637739 |
gctagggtgtgcaatggggtagtcaagactacttaacataaactttatgcattccgaatcattagaaaattattttgcaatgaaatgaagcattcaaatc |
45637838 |
T |
|
| Q |
157 |
atgattcaataaagaataatcagggagagtgcaaaacactgatattcaa |
205 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45637839 |
atgactcaataaagaataatcaggaagagtgcaaaacactgatattcaa |
45637887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 121 - 229
Target Start/End: Original strand, 11648727 - 11648835
Alignment:
| Q |
121 |
gaaaattattttgcaatgagctgaagtattcaaattatgattcaataaagaataatcagggagagtgcaaaacactgatattcaattggatttaccttgt |
220 |
Q |
| |
|
||||||||||||||||| | ||||| |||||||| |||||||||| ||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11648727 |
gaaaattattttgcaataaaatgaagcattcaaatcatgattcaatgaagaataatcatggagagtgcaaaccactgatattcaattggatttaccttgt |
11648826 |
T |
|
| Q |
221 |
tagctgcaa |
229 |
Q |
| |
|
||| ||||| |
|
|
| T |
11648827 |
tagttgcaa |
11648835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 11648069 - 11648120
Alignment:
| Q |
1 |
attaattgaatgaatatatttgtaaaaacgcttcaattcattatagtaaact |
52 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11648069 |
attaattgaatgaatatatttgtaaaaacatttcaattcattatagtaaact |
11648120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University