View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18936_high_84 (Length: 240)
Name: NF18936_high_84
Description: NF18936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18936_high_84 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 19 - 240
Target Start/End: Complemental strand, 15288695 - 15288471
Alignment:
| Q |
19 |
gcttcccatatcccttctttgtttatacttgatccttttgtcccttactccttttgcaccaactaagcttcttcattctaccaccatttccacctaccac |
118 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15288695 |
gcttcccatatcccttctttgtatatacttgatccttttgtcccttactccttttgcaccaactaagcttcttcattctaccaccatttccacctaccac |
15288596 |
T |
 |
| Q |
119 |
tattcatctacttactcttctcctccttcaacttcttttgtaggtaaatatgcatgcataatta---agttcttttaaatatcatgctagttgagattgt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15288595 |
tattcatctacttactcttctcctccttcaacttcttttgtaggtaaatatgcatgcataattaattagttcttttaaatatcatgctagttgagattgt |
15288496 |
T |
 |
| Q |
216 |
catgaactctaactagcaatttgtt |
240 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
15288495 |
catgaactctaactagcaatttgtt |
15288471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University