View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18936_high_88 (Length: 238)
Name: NF18936_high_88
Description: NF18936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18936_high_88 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 2019702 - 2019920
Alignment:
| Q |
1 |
cgacatgtaatcttcactttgacttagagtcggcccaacaccttcgtaggccgacagctttgtgaggctttttatgannnnnnnnattatggttatgatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2019702 |
cgacatgtaatcttcactttgacttagagtcggcccaacaccttcgtaggccgacagctttgtgaggctttttatgattttttttattatggttatgatc |
2019801 |
T |
 |
| Q |
101 |
acaaatgcagttatgatcattaatttattgtaatcactttgacacagaccacggttgttgcatgataaatttaaatttgatagctgatatgcactatttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2019802 |
acaaatgcagttatgatcattaatttattgtaatcactttgacacagaccacggttgttgcatgataaa-ttaaatttgatagctgatatgcactatttt |
2019900 |
T |
 |
| Q |
201 |
gatagtttttgtggatctag |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
2019901 |
gatagtttttgtggatctag |
2019920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University