View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18936_high_92 (Length: 235)
Name: NF18936_high_92
Description: NF18936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18936_high_92 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 3 - 135
Target Start/End: Original strand, 2389538 - 2389669
Alignment:
| Q |
3 |
aactataataaacaggaaaaccctccctcacaaaatttaacatcactgcattctcaagtctggattaacatactagatagcctacaaaaatatgctgagc |
102 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2389538 |
aactataataaacaggaaaactctccctcacaaaatttaacatcactgcattctcaagtctggattaacatactagatagcctacaaaaatatgc-gagc |
2389636 |
T |
 |
| Q |
103 |
ataatagatagcctataaatttgtgaaattaag |
135 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
2389637 |
ataatagatagcttataaatttgtgaaattaag |
2389669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 132 - 235
Target Start/End: Original strand, 2390373 - 2390476
Alignment:
| Q |
132 |
taagtctctaaaagcatagctcaagtgttatgaacattacatgtccgtaataggcagggatcgtgagtcgaacctcggactcttcatttatgcggtgaat |
231 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||| |||||||||||||||||||||| |||| || ||||||||| ||||| ||||||| |
|
|
| T |
2390373 |
taagtctctaaaagcataactcaagtgttatgaacattgcatgtctgtaataggcagggatcgtgagttgaacatcagactcttcacttatgaggtgaat |
2390472 |
T |
 |
| Q |
232 |
ttat |
235 |
Q |
| |
|
|||| |
|
|
| T |
2390473 |
ttat |
2390476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University