View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18936_high_94 (Length: 234)
Name: NF18936_high_94
Description: NF18936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18936_high_94 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 10100598 - 10100821
Alignment:
| Q |
1 |
atcaggtgaaaaagttatgaatgttgaatctagggcaagaaactatatatggcaacagctactacaatatgcgttatttaacttcatgtgagggacaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10100598 |
atcaggtgaaaaagttatgaatgttgaatctagggcaagaaactatatatggcaacagctactacaatatgcgttatttaacttcatgtgagggacaagg |
10100697 |
T |
 |
| Q |
101 |
tctacgtttatgtgatagc--tagttttctcttttatttaagagtgtgtgttactttttaaccaattctatgtacttttattttatgaagacttctatgt |
198 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10100698 |
tctacgtttatgtgatagctatagttttctcttttatttaagagtgtctgttagtttttaaccaattctatgtacttttgttttatgaagacttctatgt |
10100797 |
T |
 |
| Q |
199 |
acttttatatatgtggtgttttat |
222 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
10100798 |
acttttatatatgtggtgttttat |
10100821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University