View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18936_high_98 (Length: 228)

Name: NF18936_high_98
Description: NF18936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18936_high_98
NF18936_high_98
[»] chr4 (3 HSPs)
chr4 (71-210)||(51303495-51303635)
chr4 (149-210)||(5204467-5204528)
chr4 (83-210)||(9536153-9536281)
[»] chr2 (1 HSPs)
chr2 (1-210)||(35061646-35061856)


Alignment Details
Target: chr4 (Bit Score: 101; Significance: 3e-50; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 71 - 210
Target Start/End: Complemental strand, 51303635 - 51303495
Alignment:
71 tttctccgcaatgttatggcaccacttaggtttcaccaatcttgatttcttctcttctactgatgcttac-agtggcttaaaggggaaactaagggttcc 169  Q
    |||||| || |||||||||||||||||||||||||| |||| ||| ||||||||||||| |||||||||| ||||||||||||||| |||||||||||||    
51303635 tttctctgctatgttatggcaccacttaggtttcactaatcctgaattcttctcttctattgatgcttacgagtggcttaaagggggaactaagggttcc 51303536  T
170 catgctatcactttttctgtcggagtttggtggtcttggcg 210  Q
    |||||||||||||||||||||||||||||||| ||||||||    
51303535 catgctatcactttttctgtcggagtttggtgatcttggcg 51303495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 149 - 210
Target Start/End: Complemental strand, 5204528 - 5204467
Alignment:
149 aaaggggaaactaagggttcccatgctatcactttttctgtcggagtttggtggtcttggcg 210  Q
    ||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
5204528 aaagggggaactaagggttcccatgctatcactttttatgtcggagtttggtggtcttggcg 5204467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 83 - 210
Target Start/End: Original strand, 9536153 - 9536281
Alignment:
83 gttatggcaccacttaggtttcaccaatcttgatttcttctcttctactgatgcttac-agtggcttaaaggggaaactaagggttcccatgctatcact 181  Q
    ||||||| |||||||||||||||| |||   ||||  || ||||||| ||||| |||| | ||||||| |  || | ||||||||||  | |||||||||    
9536153 gttatggaaccacttaggtttcactaatgcggattctttttcttctattgatgtttacgaatggcttagaaagggagctaagggttcttaggctatcact 9536252  T
182 ttttctgtcggagtttggtggtcttggcg 210  Q
    || ||||| ||||||||||||||||||||    
9536253 ttctctgttggagtttggtggtcttggcg 9536281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 35061856 - 35061646
Alignment:
1 ctccttcggctacttgctctcgctgcggtctttaaaatgagacctttatacattgtgttcgtgactttactttctccgcaatgttatggcaccacttagg 100  Q
    ||||||| |||||||||||||| ||| ||||  | || || |||||| | |||||||||| ||||| |||||||||| |  |||||||||||||||||||    
35061856 ctccttctgctacttgctctcgttgccgtctccagaacgatacctttctccattgtgttcatgactgtactttctccactttgttatggcaccacttagg 35061757  T
101 tttcaccaatcttgatttcttctcttctactgatgctta-cagtggcttaaaggggaaactaagggttcccatgctatcactttttctgtcggagtttgg 199  Q
    |||||| |||| |||||| ||||||| ||  ||||||||  | |||||||   ||| | |||||||||| || |||| |||||||||||| |||||||||    
35061756 tttcactaatcatgattttttctcttttatggatgcttatgattggcttaggaggggagctaagggttctcaggctaacactttttctgtgggagtttgg 35061657  T
200 tggtcttggcg 210  Q
    |||||||||||    
35061656 tggtcttggcg 35061646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University