View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18936_low_106 (Length: 233)
Name: NF18936_low_106
Description: NF18936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18936_low_106 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 2390560 - 2390744
Alignment:
| Q |
1 |
taaaataaagaaatgtatttatttatagatactaattttagactatataaagggaatacattattttggaatgctagaatgtataacaaagttaaattac |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2390560 |
taaaataaagaaatgtgtttatttatagatactaattttagactatacaaagggaatacattattttggaatgctagaatgtataacaaagttaaattac |
2390659 |
T |
|
| Q |
101 |
gattttcaataaataaat--aaaaatatgtataacaaacacaaactgattttgccccgtttttctgaacaaaaataaaacgaatata |
185 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2390660 |
gattttcaagaaataaattaaaaaatatgtataacaa--acaaactgattttgccccgtttttctgaacaaaagtaaaacgaatata |
2390744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 187 - 221
Target Start/End: Original strand, 2390765 - 2390799
Alignment:
| Q |
187 |
cggaaatctgcttcaatttagggttaagtattatt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
2390765 |
cggaaatctgcttcaatttagggttaagtattatt |
2390799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University