View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18936_low_36 (Length: 396)
Name: NF18936_low_36
Description: NF18936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18936_low_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 8 - 379
Target Start/End: Complemental strand, 14192634 - 14192263
Alignment:
| Q |
8 |
agcagcacagatcttttccctggtttcaaatattgggtcttcggcatctattgctggctgattaagtttactgagaaactgtaacagaaaacaaccatcc |
107 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| || |||||||| ||| || | |||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
14192634 |
agcagcacacatcttttccctggtttcaaatattgggtcttggggatctattgttgggtgttcaagtctactgagaagctgtaacagaaaacaaccatcc |
14192535 |
T |
 |
| Q |
108 |
aatatcattgttctcccgataacatctgcagttaattctgaacctaagatgctagcatcatagcttgcgcgggtgtctatttcaaatatgggaatatcta |
207 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14192534 |
aatatcatttttctcccgataacatctgtagttaattctgaacctaagatgctaccatcatagcttgcgcggatgtctatttcaaatatgggaatatctt |
14192435 |
T |
 |
| Q |
208 |
cgttacatgcccttaacattgtcatgaatagttctggttcatgctgctggttttcttgacgcagaaacctgtccatgtattgccatttattgcctaccat |
307 |
Q |
| |
|
|| ||||||| |||||| |||| |||| | ||||| ||| |||||||||||||||| |||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
14192434 |
cgctacatgcacttaaccttgtgtcgaatgttcctggtacattctgctggttttcttgaagcagaaacctgttcatgtattgccatttaatgcctaccat |
14192335 |
T |
 |
| Q |
308 |
caattggacttggtggtagctcgtttctcccctgggtaagaaccctataaagatagactttggcgtgtaagc |
379 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14192334 |
caattggacttggcggtagttcgtttctcccctgggtaagagtcctataaagatagactttggcgtgtaagc |
14192263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University