View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18936_low_50 (Length: 311)
Name: NF18936_low_50
Description: NF18936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18936_low_50 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 276; Significance: 1e-154; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 22 - 301
Target Start/End: Original strand, 48879508 - 48879787
Alignment:
| Q |
22 |
aagcagaagtttccatactcaaaaaggcaacaacatgtggttccagctgagcaagagtagtattcatcacatacagttgaaggctgaacaggtgatggag |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48879508 |
aagcagaagtttccatactcaaaaaggcaacaacatgtggttccagctgagcaagagtagtattcatcacatacagttgaaggctgaacaggtgatggag |
48879607 |
T |
|
| Q |
122 |
gtgaaggaccaggatttggtgggttctgacccttcttgataggataggatgcctccattgcaattccacacttgccagtttcttttgttaacaaatttct |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48879608 |
gtgaaggaccaggatttggtgggttctgacccttcttgataggatatgatgcctccattgcaattccacacttgccagtttcttttgttaacaaatttct |
48879707 |
T |
|
| Q |
222 |
ctccatcttaatgtagccattttcaccccatgatgaaccccatgagttcctcactaaccagtaatcgatcccgttctctg |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48879708 |
ctccatcttaatgtagccattttcaccccatgatgaaccccatgagttcctcactaaccagtaatcgatcccgttctctg |
48879787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 145 - 185
Target Start/End: Complemental strand, 24743695 - 24743655
Alignment:
| Q |
145 |
ttctgacccttcttgataggataggatgcctccattgcaat |
185 |
Q |
| |
|
|||||||| |||||||||||||| |||| |||||||||||| |
|
|
| T |
24743695 |
ttctgaccattcttgataggatatgatggctccattgcaat |
24743655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University