View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18936_low_63 (Length: 277)
Name: NF18936_low_63
Description: NF18936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18936_low_63 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 108 - 241
Target Start/End: Complemental strand, 35757019 - 35756883
Alignment:
| Q |
108 |
tttaattaattattattgtgggagaataaattatctctattttttaagggaaattatctctttttaactatggttagaattcttgtnnnnnnnnctatgg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35757019 |
tttaattaattattattgtgggagaataaattatctctattttttaagggaaattatctctttttaactatggttagaattcttgtaaaaaaaactatgg |
35756920 |
T |
|
| Q |
208 |
ttaga---ttttttttaaagaactatggttagaattt |
241 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35756919 |
ttagatttttttttttaaagaactatggttagaattt |
35756883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 18 - 115
Target Start/End: Complemental strand, 35757302 - 35757205
Alignment:
| Q |
18 |
actaacggcatttttgaaaaaactagctctaatcgtgcaaatgtgtttatttcgacacaaacctaatgccgagggaccaaattatttctttttaatta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35757302 |
actaacggcatttttgaaaaaactagctctaatcgtgcaaatgtgtttatttcgacacaaacctaatgccgagggaccaaattatttctttttaatta |
35757205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University