View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18936_low_64 (Length: 272)
Name: NF18936_low_64
Description: NF18936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18936_low_64 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 18 - 246
Target Start/End: Original strand, 31864493 - 31864721
Alignment:
| Q |
18 |
acatattaaatgaatatgttaggtggtatttgagtagtctaaagttgatcctctaccaaggatgcatggtgcaacctactgtaaagtggttggattaaga |
117 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31864493 |
acatattaaatgaatctgttaggtggtatttgagtagtctaaagttgatcctctaccaaggatgcatggtgcaacctactgtaaagtggttggattaaga |
31864592 |
T |
|
| Q |
118 |
gagaattatttatgtcttaagaaaataaatttcaatcaagagtggttgcagaaccgttggatatatttcaatcacaattgcaattagagcttcatcgtca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31864593 |
gagaattatttatgtcttaagaaaataaatttcaatcaagagtggttgcagaaccgttggatatatttcaatcacaattgcaattagagcttcatcgtca |
31864692 |
T |
|
| Q |
218 |
tagtctttagcgcttttgtgggtttttga |
246 |
Q |
| |
|
|||||||||||||||||| |||||||||| |
|
|
| T |
31864693 |
tagtctttagcgcttttgcgggtttttga |
31864721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 78 - 160
Target Start/End: Original strand, 31933513 - 31933595
Alignment:
| Q |
78 |
gatgcatggtgcaacctactgtaaagtggttggattaagagagaattatttatgtcttaagaaaataaatttcaatcaagagt |
160 |
Q |
| |
|
||||||||||||| ||||||| | ||||||||| ||||||||||||||||||| |||| |||||||||||| |||| ||||| |
|
|
| T |
31933513 |
gatgcatggtgcagcctactgcagagtggttgggttaagagagaattatttatttcttgggaaaataaatttaaatcgagagt |
31933595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University