View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18936_low_65 (Length: 271)

Name: NF18936_low_65
Description: NF18936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18936_low_65
NF18936_low_65
[»] chr4 (1 HSPs)
chr4 (19-198)||(11321486-11321664)


Alignment Details
Target: chr4 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 19 - 198
Target Start/End: Original strand, 11321486 - 11321664
Alignment:
19 gtagaattttaggattctaatcgggattttaacaactatgaacataatacttttcaacaaaacatattaattccaactgaactttctgtgcacattatag 118  Q
    ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
11321486 gtagaattttaggattcaattcgggattttaacaactatgaacataatacttttcaacaaa-catattaattccaactgaactttctgtgcacattatag 11321584  T
119 agaagaaagaatccaacatctatatcacggttttatcaattgtatcacacaattggtcaataccaaaactggttacaggt 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||  |||||||| || |||||||||||||||||||||    
11321585 agaagaaagaatccaacatctatatcacggttttatcaattgtattgcacaattgatcgataccaaaactggttacaggt 11321664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University