View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18936_low_65 (Length: 271)
Name: NF18936_low_65
Description: NF18936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18936_low_65 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 19 - 198
Target Start/End: Original strand, 11321486 - 11321664
Alignment:
| Q |
19 |
gtagaattttaggattctaatcgggattttaacaactatgaacataatacttttcaacaaaacatattaattccaactgaactttctgtgcacattatag |
118 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11321486 |
gtagaattttaggattcaattcgggattttaacaactatgaacataatacttttcaacaaa-catattaattccaactgaactttctgtgcacattatag |
11321584 |
T |
 |
| Q |
119 |
agaagaaagaatccaacatctatatcacggttttatcaattgtatcacacaattggtcaataccaaaactggttacaggt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
11321585 |
agaagaaagaatccaacatctatatcacggttttatcaattgtattgcacaattgatcgataccaaaactggttacaggt |
11321664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University